Skip to main content

RK5F-YAP8SA
(Plasmid #125008)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 125008 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    RK5
  • Backbone size w/o insert (bp) 4700
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    YAP8SA
  • Species
    H. sapiens (human)
  • GenBank ID
    NM_001130145.3
  • Entrez Gene
    YAP1 (a.k.a. COB1, YAP, YAP-1, YAP2, YAP65, YKI)
  • Promoter CMV
  • Tag / Fusion Protein
    • FLAG (C terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (unknown if destroyed)
  • 3′ cloning site XbaI (unknown if destroyed)
  • 5′ sequencing primer ccactttgcctttctctcca
  • 3′ sequencing primer tttgtgaaatttgtgatgctattg
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    ADDGENE (#33093)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    RK5F-YAP8SA was a gift from Ruey-Hwa Chen (Addgene plasmid # 125008 ; http://n2t.net/addgene:125008 ; RRID:Addgene_125008)
  • For your References section:

    LncRNA NORAD is repressed by the YAP pathway and suppresses lung and breast cancer metastasis by sequestering S100P. Tan BS, Yang MC, Singh S, Chou YC, Chen HY, Wang MY, Wang YC, Chen RH. Oncogene. 2019 Jul;38(28):5612-5626. doi: 10.1038/s41388-019-0812-8. Epub 2019 Apr 9. 10.1038/s41388-019-0812-8 PubMed 30967631