pKmK.P17
(Plasmid
#125050)
-
PurposeStorage plasmid for K.marxianus promoter; type 2 part
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 125050 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backboneYTK001
-
Backbone manufacturerDueber lab, UC Berkeley
- Backbone size w/o insert (bp) 1667
-
Vector typeYeast Expression, Synthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Chloramphenicol, 25 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameXYL1 promoter
-
Insert Size (bp)630
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BsmBI (destroyed during cloning)
- 3′ cloning site BsmBI (destroyed during cloning)
- 5′ sequencing primer tttgctggccttttgctc
- 3′ sequencing primer catctggatttgttcagaacg
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Promoter inducible by xylose. Contains the appropriate YTK-compatible Golden Gate overhangs for a type 2 part Please note that the minor differences between the Addgene NGS results and depositor's annotated sequence do not affect the plasmid function.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pKmK.P17 was a gift from John Morrissey (Addgene plasmid # 125050 ; http://n2t.net/addgene:125050 ; RRID:Addgene_125050) -
For your References section:
Biological Parts for Kluyveromyces marxianus Synthetic Biology. Rajkumar AS, Varela JA, Juergens H, Daran JG, Morrissey JP. Front Bioeng Biotechnol. 2019 May 7;7:97. doi: 10.3389/fbioe.2019.00097. eCollection 2019. 10.3389/fbioe.2019.00097 PubMed 31134195