Skip to main content

pOTTC1740 - pAAV SYN1 DIO HA-hM4D(Gi)
(Plasmid #125146)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 125146 Standard format: Plasmid sent in bacteria as agar stab 1 $89

This service is available to academics and nonprofits only.

Please log in to submit a packaging request.
  • Serotype
    Select serotype for details
  • Pricing
    Select serotype and quantity
  • How this works
    • Place a request for a quantity of 2 (0.2 mL), 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
    • Addgene will quickly confirm that we can produce a high-quality prep for you.
    • Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
    • Receive your prep in 6–9 weeks after the MTA is approved by your organization.
    • Learn more about our Packaged on Request Service.

Backbone

  • Vector backbone
    pOTTC901 - pAAV SYN1 DIO GIRK4-Myc
  • Backbone manufacturer
    NIDA_GEVVC
  • Backbone size w/o insert (bp) 4811
  • Total vector size (bp) 6124
  • Vector type
    Mammalian Expression, AAV, Cre/Lox

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    HA-tagged hM4D(Gi)
  • Alt name
    Inhibitory DREADD
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1470
  • GenBank ID
    1132 CHRM4
  • Entrez Gene
    CHRM4 (a.k.a. HM4, M4R)
  • Promoter SYN1
  • Tag / Fusion Protein
    • HA (N terminal on insert)

Cloning Information

  • Cloning method Ligation Independent Cloning
  • 5′ sequencing primer hSYN1 F417 ACTCAGCGCTGCCTCAGTCT
  • 3′ sequencing primer WPRE R1 ATGAAAGCCATACGGGAAGC
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Insert was amplified from pOTTC1329, Addgene 89150
  • Article Citing this Plasmid

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pOTTC1740 - pAAV SYN1 DIO HA-hM4D(Gi) was a gift from Christopher Richie (Addgene plasmid # 125146 ; http://n2t.net/addgene:125146 ; RRID:Addgene_125146)