pOTTC1740 - pAAV SYN1 DIO HA-hM4D(Gi)
(Plasmid
#125146)
-
PurposeAn adeno-associated viral vector expressing Cre-dependent HA-tagged inhibitory DREADD (hM4D(Gi)) from a synapsin promoter
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | ||
---|---|---|---|---|---|---|
Plasmid | 125146 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $75 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepOTTC901 - pAAV SYN1 DIO GIRK4-Myc
-
Backbone manufacturerNIDA_GEVVC
- Backbone size w/o insert (bp) 4811
- Total vector size (bp) 6124
-
Vector typeMammalian Expression, AAV, Cre/Lox
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameHA-tagged hM4D(Gi)
-
Alt nameInhibitory DREADD
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1470
-
GenBank ID1132 CHRM4
-
Entrez GeneCHRM4 (a.k.a. HM4, M4R)
- Promoter SYN1
-
Tag
/ Fusion Protein
- HA (N terminal on insert)
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer hSYN1 F417 ACTCAGCGCTGCCTCAGTCT
- 3′ sequencing primer WPRE R1 ATGAAAGCCATACGGGAAGC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byInsert was amplified from pOTTC1329, Addgene 89150
-
Terms and Licenses
-
Industry Terms
- Not Available to Industry
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pOTTC1740 - pAAV SYN1 DIO HA-hM4D(Gi) was a gift from Christopher Richie (Addgene plasmid # 125146 ; http://n2t.net/addgene:125146 ; RRID:Addgene_125146)