Skip to main content
Holiday Schedule: Addgene will be closed November 24th & 25th for the Thanksgiving Holiday. Order processing and shipping may be delayed during this week. For questions about estimated ship dates, please feel free to track your order status or contact [email protected].
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pOTTC1740 - pAAV SYN1 DIO HA-hM4D(Gi)
(Plasmid #125146)


Item Catalog # Description Quantity Price (USD)
Plasmid 125146 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.


  • Vector backbone
    pOTTC901 - pAAV SYN1 DIO GIRK4-Myc
  • Backbone manufacturer
  • Backbone size w/o insert (bp) 4811
  • Total vector size (bp) 6124
  • Vector type
    Mammalian Expression, AAV, Cre/Lox

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Low Copy


  • Gene/Insert name
    HA-tagged hM4D(Gi)
  • Alt name
    Inhibitory DREADD
  • Species
    H. sapiens (human)
  • Insert Size (bp)
  • GenBank ID
    1132 CHRM4
  • Entrez Gene
    CHRM4 (a.k.a. HM4, M4R)
  • Promoter SYN1
  • Tag / Fusion Protein
    • HA (N terminal on insert)

Cloning Information

  • Cloning method Ligation Independent Cloning
  • 5′ sequencing primer hSYN1 F417 ACTCAGCGCTGCCTCAGTCT
  • 3′ sequencing primer WPRE R1 ATGAAAGCCATACGGGAAGC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pOTTC1740 - pAAV SYN1 DIO HA-hM4D(Gi) was a gift from Christopher Richie (Addgene plasmid # 125146 ; ; RRID:Addgene_125146)