pFBOH-MHL.RBBP4
(Plasmid
#125173)
-
PurposeExpresses human RBBP4 in insect cells, under a TEV-cleavable N-terminal polyhistidine tag.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 125173 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepFBOH-MHL baculovirus expression vector
-
Backbone manufacturera gift from the lab of Dr. Yufeng Tong, University of Toronto, Addgene #62304
- Backbone size w/o insert (bp) 6767
-
Modifications to backboneN-terminal His-MBP PreScission cleavage site
-
Vector typeInsect Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameHistone-binding protein RBBP4
-
Alt nameChromatin assembly factor 1 subunit C
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1278
-
GenBank ID5928 5928
-
Entrez GeneRBBP4 (a.k.a. NURF55, RBAP48, lin-53)
- Promoter Polyhedrin
-
Tag
/ Fusion Protein
- His-TEV site (N terminal on backbone)
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer 5’ sequencing primer pFBOH-fwd 5’ CCGGATTATTCATACCGTCCCACCA 3’
- 3′ sequencing primer 3’ sequencing primer pFBOH-rev 5’ CTGATTATGATCCTCTAGTACTTCT 3 (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pFBOH-MHL.RBBP4 was a gift from Chen Davidovich (Addgene plasmid # 125173 ; http://n2t.net/addgene:125173 ; RRID:Addgene_125173) -
For your References section:
RNA exploits an exposed regulatory site to inhibit the enzymatic activity of PRC2. Zhang Q, McKenzie NJ, Warneford-Thomson R, Gail EH, Flanigan SF, Owen BM, Lauman R, Levina V, Garcia BA, Schittenhelm RB, Bonasio R, Davidovich C. Nat Struct Mol Biol. 2019 Mar;26(3):237-247. doi: 10.1038/s41594-019-0197-y. Epub 2019 Mar 4. 10.1038/s41594-019-0197-y PubMed 30833789