Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #125171)


Item Catalog # Description Quantity Price (USD)
Plasmid 125171 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.


  • Vector backbone
    pFBOH-MHL baculovirus expression vector
  • Backbone manufacturer
    a gift from the lab of Dr. Yufeng Tong, University of Toronto, Addgene #62304
  • Backbone size w/o insert (bp) 6767
  • Vector type
    Insect Expression

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number


  • Gene/Insert name
  • Alt name
    Histone-lysine N-methyltransferase EZH2
  • Species
    H. sapiens (human)
  • Insert Size (bp)
  • GenBank ID
  • Entrez Gene
    EZH2 (a.k.a. ENX-1, ENX1, EZH2b, KMT6, KMT6A, WVS, WVS2)
  • Promoter Polyhedrin
  • Tag / Fusion Protein
    • His-TEV (N terminal on backbone)

Cloning Information

  • Cloning method Unknown
  • 5′ sequencing primer 5’ sequencing primer pFBOH-fwd 5’ CCGGATTATTCATACCGTCCCACCA 3’
  • 3′ sequencing primer 3’ sequencing primer pFBOH-rev 5’ CTGATTATGATCCTCTAGTACTTCT 3
  • (Common Sequencing Primers)

Resource Information

  • Terms and Licenses
  • Industry Terms
    • Not Available to Industry
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pFBOH-MHL.EZH2 was a gift from Chen Davidovich (Addgene plasmid # 125171 ; ; RRID:Addgene_125171)
  • For your References section:

    RNA exploits an exposed regulatory site to inhibit the enzymatic activity of PRC2. Zhang Q, McKenzie NJ, Warneford-Thomson R, Gail EH, Flanigan SF, Owen BM, Lauman R, Levina V, Garcia BA, Schittenhelm RB, Bonasio R, Davidovich C. Nat Struct Mol Biol. 2019 Mar;26(3):237-247. doi: 10.1038/s41594-019-0197-y. Epub 2019 Mar 4. 10.1038/s41594-019-0197-y PubMed 30833789