pWZL Hygro-N FLAG
(Plasmid
#12541)
-
Depositing Lab
-
Publication
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 12541 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepWZL Hygro
-
Backbone manufacturerScott Lowe (Addgene Plasmid# 18750)
- Backbone size w/o insert (bp) 5900
-
Vector typeMammalian Expression, Retroviral
-
Selectable markersHygromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameN FLAG
-
Alt namede Lange Lab plasmid# 2410
-
Alt nameN-terminal Flag tag
-
Insert Size (bp)35
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (destroyed during cloning)
- 3′ cloning site BamHI (not destroyed)
- 5′ sequencing primer CCTTTGTACACCCTAAGCCT
- 3′ sequencing primer AATGCTCGTCAAGAAGAC
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pWZL Hygro-N FLAG was a gift from Titia de Lange (Addgene plasmid # 12541 ; http://n2t.net/addgene:12541 ; RRID:Addgene_12541)
Map uploaded by the depositor.