Skip to main content

AAV-EF1A-mScarlet-Gephyrin.FingR-IL2RGTC
(Plasmid #125695)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 125695 Standard format: Plasmid sent in bacteria as agar stab 1 $89

This service is available to academics and nonprofits only.

Please log in to submit a packaging request.
  • Serotype
    Select serotype for details
  • Pricing
    Select serotype and quantity
  • How this works
    • Place a request for a quantity of 2 (0.2 mL), 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
    • Addgene will quickly confirm that we can produce a high-quality prep for you.
    • Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
    • Receive your prep in 6–9 weeks after the MTA is approved by your organization.
    • Learn more about our Packaged on Request Service.

Backbone

  • Vector backbone
    AAV2
  • Backbone size w/o insert (bp) 4589
  • Total vector size (bp) 6963
  • Modifications to backbone
    Inserted IL2RGTC DNA binding sequence upstream of promoter. Changed to EF1A promoter.
  • Vector type
    Mammalian Expression, AAV

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    mScarlet-Gephyrin.FingR-IL2RGTC
  • Insert Size (bp)
    1575
  • Promoter EF1A

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer TCAAGCCTCAGACAGTGGTTC
  • 3′ sequencing primer CCAGTCAATCTTTCACAAAT
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Part of this gene was derived from Addgene plasmids 46296 and 85044 deposited by Don Arnold and Dorus Gadella.
  • Articles Citing this Plasmid

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    AAV-EF1A-mScarlet-Gephyrin.FingR-IL2RGTC was a gift from Xue Han (Addgene plasmid # 125695 ; http://n2t.net/addgene:125695 ; RRID:Addgene_125695)
  • For your References section:

    A Viral Toolbox of Genetically Encoded Fluorescent Synaptic Tags. Bensussen S, Shankar S, Ching KH, Zemel D, Ta TL, Mount RA, Shroff SN, Gritton HJ, Fabris P, Vanbenschoten H, Beck C, Man HY, Han X. iScience. 2020 Jun 30;23(7):101330. doi: 10.1016/j.isci.2020.101330. 10.1016/j.isci.2020.101330 PubMed 32674057