pEGFP-SUN1_785
(Plasmid
#125852)
-
PurposeExpresses SUN1_785 tagged with GFP in mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 125852 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepEGFP-N3
-
Backbone manufacturerClontech
- Backbone size w/o insert (bp) 4700
- Total vector size (bp) 7052
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameSUN1_785
-
SpeciesH. sapiens (human)
-
Insert Size (bp)2352
-
GenBank IDNM001130965
-
Entrez GeneSUN1 (a.k.a. UNC84A)
-
Tag
/ Fusion Protein
- GFP (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Bgl II (unknown if destroyed)
- 3′ cloning site Sal I (unknown if destroyed)
- 5′ sequencing primer AAATTAGATCTGCCACCATGGATTTTTCTCGGCTTCACATGTACAGT
- 3′ sequencing primer AAATTGTCGACCTTGACAGGTTCGCCATGAACTCTGAACCG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pEGFP-SUN1_785 was a gift from Miki Hieda (Addgene plasmid # 125852 ; http://n2t.net/addgene:125852 ; RRID:Addgene_125852) -
For your References section:
SUN1 splice variants, SUN1_888, SUN1_785, and predominant SUN1_916, variably function in directional cell migration. Nishioka Y, Imaizumi H, Imada J, Katahira J, Matsuura N, Hieda M. Nucleus. 2016 Nov;7(6):572-584. doi: 10.1080/19491034.2016.1260802. 10.1080/19491034.2016.1260802 PubMed 27858498