Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pLSU4cg10
(Plasmid #126078)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 126078 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pLSU4
  • Backbone manufacturer
    Lee et al., 2012
  • Backbone size w/o insert (bp) 5379
  • Vector type
    Plant Expression ; Binary
  • Selectable markers
    Hygromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Chloroplastic FNR transit peptide
  • Alt name
    FNR (tp)
  • Species
    Spinacia oleracea
  • Insert Size (bp)
    834
  • GenBank ID
    M86349.1
  • Promoter longCaMV35S
  • Tag / Fusion Protein
    • GFP1-10 (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BsaI (destroyed during cloning)
  • 3′ cloning site BsaI (destroyed during cloning)
  • 5′ sequencing primer ATGACGCACAATCCCACTATCC
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLSU4cg10 was a gift from Ralf-Bernd Klösgen (Addgene plasmid # 126078 ; http://n2t.net/addgene:126078 ; RRID:Addgene_126078)
  • For your References section:

    Targeting specificity of nuclear-encoded organelle proteins with a self-assembling split-fluorescent protein toolkit. Sharma M, Kretschmer C, Lampe C, Stuttmann J, Klosgen RB. J Cell Sci. 2019 Jun 3;132(11). pii: jcs.230839. doi: 10.1242/jcs.230839. 10.1242/jcs.230839 PubMed 31085714