Skip to main content

pcDNA3.1(+) Laccase2 MCS-mFndc3b Mutant miRNAs
(Plasmid #126444)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 126444 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pcDNA3.1(+) Laccase2 MCS Exon
  • Total vector size (bp) 7399
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    Fndc3b
  • Species
    M. musculus (mouse)
  • Mutation
    circFndc3b exons are separated by a miniature intron derived from the mouse Jmjd1c gene
  • Entrez Gene
    Fndc3b (a.k.a. 1600019O04Rik, AW550168, Fad104, mKIAA4164)
  • Promoter CMV

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site PacI (not destroyed)
  • 3′ cloning site SacII (not destroyed)
  • 5′ sequencing primer gatcctgatcaagaatatatatactttataccgcttcc
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pcDNA3.1(+) Laccase2 MCS-mFndc3b Mutant miRNAs was a gift from Jeremy Wilusz (Addgene plasmid # 126444 ; http://n2t.net/addgene:126444 ; RRID:Addgene_126444)
  • For your References section:

    Circular RNA CircFndc3b modulates cardiac repair after myocardial infarction via FUS/VEGF-A axis. Garikipati VNS, Verma SK, Cheng Z, Liang D, Truongcao MM, Cimini M, Yue Y, Huang G, Wang C, Benedict C, Tang Y, Mallaredy V, Ibetti J, Grisanti L, Schumacher SM, Gao E, Rajan S, Wilusz JE, Goukassian D, Houser SR, Koch WJ, Kishore R. Nat Commun. 2019 Sep 20;10(1):4317. doi: 10.1038/s41467-019-11777-7. 10.1038/s41467-019-11777-7 PubMed 31541092