pcDNA3.1(+) Laccase2 MCS-mFndc3b Mutant miRNAs
(Plasmid
#126444)
-
PurposeExpresses a mutated version of mouse Fndc3b circular RNA with the miR-93-3p, miR-258-5p, and miR-412-3p target sites all mutated
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 126444 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepcDNA3.1(+) Laccase2 MCS Exon
- Total vector size (bp) 7399
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameFndc3b
-
SpeciesM. musculus (mouse)
-
MutationcircFndc3b exons are separated by a miniature intron derived from the mouse Jmjd1c gene
-
Entrez GeneFndc3b (a.k.a. 1600019O04Rik, AW550168, Fad104, mKIAA4164)
- Promoter CMV
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site PacI (not destroyed)
- 3′ cloning site SacII (not destroyed)
- 5′ sequencing primer gatcctgatcaagaatatatatactttataccgcttcc (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pcDNA3.1(+) Laccase2 MCS-mFndc3b Mutant miRNAs was a gift from Jeremy Wilusz (Addgene plasmid # 126444 ; http://n2t.net/addgene:126444 ; RRID:Addgene_126444) -
For your References section:
Circular RNA CircFndc3b modulates cardiac repair after myocardial infarction via FUS/VEGF-A axis. Garikipati VNS, Verma SK, Cheng Z, Liang D, Truongcao MM, Cimini M, Yue Y, Huang G, Wang C, Benedict C, Tang Y, Mallaredy V, Ibetti J, Grisanti L, Schumacher SM, Gao E, Rajan S, Wilusz JE, Goukassian D, Houser SR, Koch WJ, Kishore R. Nat Commun. 2019 Sep 20;10(1):4317. doi: 10.1038/s41467-019-11777-7. 10.1038/s41467-019-11777-7 PubMed 31541092