pLmoCascade-IL1RNcrRNA
(Plasmid
#126487)
-
PurposeEncodes L.monocytogenes CRISPR Type I-B crRNA targeting IL1RN
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 126487 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepcDNA
- Total vector size (bp) 3225
-
Vector typeMammalian Expression, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameLmo IL1RN cr03
-
gRNA/shRNA sequenceAGCAGGCCCAGTTTCCAGGAGGGTGACTCAGGC
- Promoter U6
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site SacII (not destroyed)
- 3′ cloning site AgeI (not destroyed)
- 5′ sequencing primer TAATACGACTCACTATAGG
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLmoCascade-IL1RNcrRNA was a gift from Charles Gersbach (Addgene plasmid # 126487 ; http://n2t.net/addgene:126487 ; RRID:Addgene_126487) -
For your References section:
Targeted transcriptional modulation with type I CRISPR-Cas systems in human cells. Pickar-Oliver A, Black JB, Lewis MM, Mutchnick KJ, Klann TS, Gilcrest KA, Sitton MJ, Nelson CE, Barrera A, Bartelt LC, Reddy TE, Beisel CL, Barrangou R, Gersbach CA. Nat Biotechnol. 2019 Sep 23. pii: 10.1038/s41587-019-0235-7. doi: 10.1038/s41587-019-0235-7. 10.1038/s41587-019-0235-7 PubMed 31548729