pLenti-LmoCas7
(Plasmid
#126489)
-
PurposeEncodes lentivirus expression of L. monocytogenes CRISPR Type I-B Flag-Cas7 driven by hUbC promoter
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 126489 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backboneFUGW
- Total vector size (bp) 10146
-
Vector typeMammalian Expression, Lentiviral, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameLmoCas7
-
Insert Size (bp)930
- Promoter hUbC
-
Tag
/ Fusion Protein
- Flag, NLS (N terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer GCTCCGGTTTTGAACTATGCG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLenti-LmoCas7 was a gift from Charles Gersbach (Addgene plasmid # 126489 ; http://n2t.net/addgene:126489 ; RRID:Addgene_126489) -
For your References section:
Targeted transcriptional modulation with type I CRISPR-Cas systems in human cells. Pickar-Oliver A, Black JB, Lewis MM, Mutchnick KJ, Klann TS, Gilcrest KA, Sitton MJ, Nelson CE, Barrera A, Bartelt LC, Reddy TE, Beisel CL, Barrangou R, Gersbach CA. Nat Biotechnol. 2019 Sep 23. pii: 10.1038/s41587-019-0235-7. doi: 10.1038/s41587-019-0235-7. 10.1038/s41587-019-0235-7 PubMed 31548729