pHAGE-EF1aL-TagBFP-W
(Plasmid
#126687)
-
PurposeConstitutive, ubiquitous blue fluorescence protein (BFP) expression.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 126687 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepHAGE
-
Backbone manufacturerDerived in Kotton lab
- Backbone size w/o insert (bp) 6978
-
Vector typeLentiviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameTagBFP
-
SpeciesSynthetic
-
Insert Size (bp)702
- Promoter Ef1aL
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NotI (not destroyed)
- 3′ cloning site BamHI (not destroyed)
- 5′ sequencing primer ggttcattctcaagcctcagacagtg
- 3′ sequencing primer gctattgcttcccgtatggctttc
- (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pHAGE-EF1aL-TagBFP-W was a gift from Darrell Kotton (Addgene plasmid # 126687 ; http://n2t.net/addgene:126687 ; RRID:Addgene_126687) -
For your References section:
Derivation of self-renewing lung alveolar epithelial type II cells from human pluripotent stem cells. Jacob A, Vedaie M, Roberts DA, Thomas DC, Villacorta-Martin C, Alysandratos KD, Hawkins F, Kotton DN. Nat Protoc. 2019 Dec;14(12):3303-3332. doi: 10.1038/s41596-019-0220-0. Epub 2019 Nov 15. 10.1038/s41596-019-0220-0 PubMed 31732721