-
PurposeUCOE-SFFV-dCas9-BFP-KRAB
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 85969 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $75 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepHR-SFFV-dCas9-BFP-KRAB
-
Modifications to backboneinsertion of minimal UCOE upstream of SFFV promoter
-
Vector typeMammalian Expression, Lentiviral
-
Selectable markersBFP fluorescence
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namedCas9
-
Alt namenuclease-deficient Cas9
-
SpeciesStreptococcus pyogenes
-
MutationD10A, H840A
- Promoter SFFV
-
Tag
/ Fusion Protein
- BFP-KRAB (C terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer AGTGCAGGGGAAAGAATAGTAGAC
- 3′ sequencing primer CTGAACTTCTCTATTCTTGGTTTGG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pMH0001 was a gift from Jonathan Weissman (Addgene plasmid # 85969 ; http://n2t.net/addgene:85969 ; RRID:Addgene_85969) -
For your References section:
A Multiplexed Single-Cell CRISPR Screening Platform Enables Systematic Dissection of the Unfolded Protein Response. Adamson B, Norman TM, Jost M, Cho MY, Nunez JK, Chen Y, Villalta JE, Gilbert LA, Horlbeck MA, Hein MY, Pak RA, Gray AN, Gross CA, Dixit A, Parnas O, Regev A, Weissman JS. Cell. 2016 Dec 15;167(7):1867-1882.e21. doi: 10.1016/j.cell.2016.11.048. 10.1016/j.cell.2016.11.048 PubMed 27984733