Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #84832)


Item Catalog # Description Quantity Price (USD)
Plasmid 84832 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.


  • Vector backbone
    pSICO derivative
  • Backbone manufacturer
  • Backbone size w/o insert (bp) 8200
  • Total vector size (bp) 8888
  • Vector type
    Mammalian Expression, Lentiviral, CRISPR
  • Selectable markers

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
  • Insert Size (bp)
  • Promoter mU6

Cloning Information for Gene/Insert 1

  • Cloning method Restriction Enzyme
  • 5′ cloning site BstX1 (not destroyed)
  • 3′ cloning site Blp1 (not destroyed)
  • 5′ sequencing primer gcgccaattctgcagacaaa
  • 3′ sequencing primer CCTTCTCTAGGCACCGGTTC
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
  • Insert Size (bp)

Resource Information

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCRISPRia-v2 was a gift from Jonathan Weissman (Addgene plasmid # 84832 ; ; RRID:Addgene_84832)
  • For your References section:

    Compact and highly active next-generation libraries for CRISPR-mediated gene repression and activation. Horlbeck MA, Gilbert LA, Villalta JE, Adamson B, Pak RA, Chen Y, Fields AP, Park CY, Corn JE, Kampmann M, Weissman JS. Elife. 2016 Sep 23;5. pii: e19760. doi: 10.7554/eLife.19760. 10.7554/eLife.19760 PubMed 27661255