pX330-Flag-Sniper SpCas9 (without sgRNA; with silent mutations)
(Plasmid
#126777)
-
PurposeExpression plasmid for human codon-optimized increased fidelity Sniper SpCas9 (without U6-sgRNA coding sequence, with silent mutations)
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 126777 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepX330-like (without U6-sgRNA coding sequence)
- Total vector size (bp) 8077
-
Vector typeMammalian Expression, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameSniper SpCas9
-
SpeciesS. pyogenes
-
Insert Size (bp)4272
-
MutationF539S, M763I, K890N
- Promoter CBh
-
Tags
/ Fusion Proteins
- 3xFLAG (N terminal on insert)
- NLS (N terminal on insert)
- NLS (C terminal on insert)
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer GGAAGCAGCGGACCTTCGAC
- 3′ sequencing primer CACGACGGCGTTCAGGTACGC (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
pCbh-3xFLAG-NLS-Sniper SpCas9-NLS (without U6-sgRNA coding sequence, with silent mutations).
The lack of sgRNA expression cassette allows for easy testing of various SpCas9 variants with the same sgRNA expressed from a separate plasmid (e.g. pmCherry_gRNA, Addgene# #80457).
For detailed information and plasmid usage, please see the associated publication.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pX330-Flag-Sniper SpCas9 (without sgRNA; with silent mutations) was a gift from Ervin Welker (Addgene plasmid # 126777 ; http://n2t.net/addgene:126777 ; RRID:Addgene_126777) -
For your References section:
Blackjack mutations improve the on-target activities of increased fidelity variants of SpCas9 with 5'G-extended sgRNAs. Kulcsar PI, Talas A, Toth E, Nyeste A, Ligeti Z, Welker Z, Welker E. Nat Commun. 2020 Mar 6;11(1):1223. doi: 10.1038/s41467-020-15021-5. 10.1038/s41467-020-15021-5 PubMed 32144253