-
PurposeT7 promoter bacterial expression plasmid for PE2 (nSpCas9(H840A)-MMLV-RT) with C-terminal 6xHis-tag and bipartite NLS
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 170103 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepET
- Backbone size w/o insert (bp) 5238
- Total vector size (bp) 11619
-
Vector typeBacterial Expression, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert namebpNLS-nSpCas9(H840A)-MMLVRT-bpNLS-6xHis
-
SpeciesSynthetic; Streptococcus pyogenes and Moloney Murine Leukemia Virus
-
Insert Size (bp)6381
-
MutationBacteria codon-optimized nSpCas9 (H840A) & M-MLV RT (D200N, T306K, W313F, T330P, L603W)
- Promoter T7
-
Tag
/ Fusion Protein
- 6xHis tag (C terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer T7 (TAATACGACTCACTATAGGG)
- 3′ sequencing primer T7 Terminal (GCTAGTTATTGCTCAGCGG) (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byM-MLV RT from the parental pCMV-PE2 plasmid (Addgene #132775)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
This is a bacterial codon-optimized SpCas9 (H840A) sequence within pET-28b backbone (Addgene #73018) fused to bipartite NLS, a 33-amino acid linker and the engineered M-MLV RT from the parental pCMV-PE2 plasmid (Addgene #132775). To this construct, a short GS linker and a 6xHis-tag are added to C terminus.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pET-PE2-His (IK1822) was a gift from Keith Joung (Addgene plasmid # 170103 ; http://n2t.net/addgene:170103 ; RRID:Addgene_170103) -
For your References section:
CRISPR prime editing with ribonucleoprotein complexes in zebrafish and primary human cells. Petri K, Zhang W, Ma J, Schmidts A, Lee H, Horng JE, Kim DY, Kurt IC, Clement K, Hsu JY, Pinello L, Maus MV, Joung JK, Yeh JJ. Nat Biotechnol. 2021 Apr 29. pii: 10.1038/s41587-021-00901-y. doi: 10.1038/s41587-021-00901-y. 10.1038/s41587-021-00901-y PubMed 33927418