pET-PE2-His (IK1822)
(Plasmid #170103)

• Purpose: T7 promoter bacterial expression plasmid for PE2 (nSpCas9(H840A)-MMLV-RT) with C-terminal 6xHis-tag and bipartite NLS
• Depositing Lab: Keith Joung
• Publication: Petri et al Nat Biotechnol. 2021 Apr 29. pii: 10.1038/s41587-021-00901-y. doi: 10.1038/s41587-021-00901-y.

Backbone

• Vector backbone: pET
• Backbone size w/o insert (bp): 5238
• Total vector size (bp): 11619
• Vector type: Bacterial Expression, CRISPR

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Low Copy

Gene/Insert

• Gene/Insert name: bpNLS-nSpCas9(H840A)-MMLVRT-bpNLS-6xHis
• Species: Synthetic; Streptococcus pyogenes and Moloney Murine Leukemia Virus
• Insert Size (bp): 6381
• Mutation: Bacteria codon-optimized nSpCas9 (H840A) & M-MLV RT (D200N, T306K, W313F, T330P, L603W)
• Promoter: T7
• Tag / Fusion Protein:
  • 6xHis tag (C terminal on insert)

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: T7 (TAATACGACTCACTATAGGG)
• 3′ sequencing primer: T7 Terminal (GCTAGTTATTGCTCAGCGG)

Resource Information

• Supplemental Documents:
  • pET-PE2-His (IK1822).gb
• A portion of this plasmid was derived from a plasmid made by: M-MLV RT from the parental pCMV-PE2 plasmid (Addgene #132775)

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

This is a bacterial codon-optimized SpCas9 (H840A) sequence within pET-28b backbone (Addgene #73018) fused to bipartite NLS, a 33-amino acid linker and the engineered M-MLV RT from the parental pCMV-PE2 plasmid (Addgene #132775). To this construct, a short GS linker and a 6xHis-tag are added to C terminus.