pre_II_CS3_7653_v2
(Plasmid
#126855)
-
Purpose7653 b scaffold from compatibility group 3, made by method II, containing 1 Zn-dependent self-cleaving DNAzyme cassette for linearisation into 7560 b scaffold
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 126855 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepBSSK(+)
-
Backbone manufacturerEurofins
-
Vector typeSynthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameII_CS3_7653_v2
-
Alt nameCS3_cut2
-
SpeciesSynthetic
-
Insert Size (bp)7653
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer CAGTGGCGATAAGTCGTGTCGCGATAAGTCGTGTC
- 3′ sequencing primer AAGAAAGCGAAAGGAGCGGG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pre_II_CS3_7653_v2 was a gift from Hendrik Dietz (Addgene plasmid # 126855 ; http://n2t.net/addgene:126855 ; RRID:Addgene_126855) -
For your References section:
Custom-Size, Functional, and Durable DNA Origami with Design-Specific Scaffolds. Engelhardt FAS, Praetorius F, Wachauf CH, Bruggenthies G, Kohler F, Kick B, Kadletz KL, Pham PN, Behler KL, Gerling T, Dietz H. ACS Nano. 2019 Apr 22. doi: 10.1021/acsnano.9b01025. 10.1021/acsnano.9b01025 PubMed 30990672