Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pre_IV_CS8_7569_v1
(Plasmid #126865)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 126865 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pSB1A3
  • Backbone manufacturer
    Idem parts registry
  • Vector type
    Synthetic Biology

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    IV_CS8_7569_v1
  • Species
    Synthetic
  • Insert Size (bp)
    7560

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Unknown (unknown if destroyed)
  • 3′ cloning site Unknown (unknown if destroyed)
  • 5′ sequencing primer attaccgcctttgagtgagc
  • 3′ sequencing primer tgccacctgacgtctaagaa
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pre_IV_CS8_7569_v1 was a gift from Hendrik Dietz (Addgene plasmid # 126865 ; http://n2t.net/addgene:126865 ; RRID:Addgene_126865)
  • For your References section:

    Custom-Size, Functional, and Durable DNA Origami with Design-Specific Scaffolds. Engelhardt FAS, Praetorius F, Wachauf CH, Bruggenthies G, Kohler F, Kick B, Kadletz KL, Pham PN, Behler KL, Gerling T, Dietz H. ACS Nano. 2019 Apr 22. doi: 10.1021/acsnano.9b01025. 10.1021/acsnano.9b01025 PubMed 30990672