pre_IV_CS6_4323_v1
(Plasmid
#126859)
-
Purpose4323 b scaffold from compatibility group 4, made by method IV, insert based on de Bruijn sequence with the an order of 7
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 126859 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepSB1A3
-
Backbone manufacturerIdem parts registry
-
Vector typeSynthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Chloramphenicol, 25 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameIV_CS6_4323_v1
-
SpeciesSynthetic
-
Insert Size (bp)4323
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer attaccgcctttgagtgagc
- 3′ sequencing primer tgccacctgacgtctaagaa
- (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pre_IV_CS6_4323_v1 was a gift from Hendrik Dietz (Addgene plasmid # 126859 ; http://n2t.net/addgene:126859 ; RRID:Addgene_126859) -
For your References section:
Custom-Size, Functional, and Durable DNA Origami with Design-Specific Scaffolds. Engelhardt FAS, Praetorius F, Wachauf CH, Bruggenthies G, Kohler F, Kick B, Kadletz KL, Pham PN, Behler KL, Gerling T, Dietz H. ACS Nano. 2019 Apr 22. doi: 10.1021/acsnano.9b01025. 10.1021/acsnano.9b01025 PubMed 30990672