(SUMO)10-(SIM)5
(Plasmid
#126866)
-
PurposeBacterial expression plasmid for multivalent scaffold of (SUMO)10-(SIM)5 biomolecular condensates to recruit SIM-containing client proteins.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 126866 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepMal-tev
-
Backbone manufacturerNEB
- Backbone size w/o insert (bp) 6600
- Total vector size (bp) 10368
-
Modifications to backbonetev sites added on either side of the NdeI / BamHI cloning site C-terminal His6 added
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert name10 repeats of human SUMO3 and 5 repeats of human SUMO interactive motif (SIM) from PIASx each separated by (GGS)4
-
SpeciesH. sapiens (human)
-
Insert Size (bp)3660
-
Entrez GeneSUMO3 (a.k.a. SMT3A, SMT3H1, SUMO-3, Smt3B)
- Promoter tac
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NdeI (not destroyed)
- 3′ cloning site BamHI (not destroyed)
- 5′ sequencing primer TGCGTACTGCGGTGATCAAC
- 3′ sequencing primer GTAAAACGACGGCCAGT
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
(SUMO)10-(SIM)5 was a gift from Michael Rosen (Addgene plasmid # 126866 ; http://n2t.net/addgene:126866 ; RRID:Addgene_126866) -
For your References section:
Compositional Control of Phase-Separated Cellular Bodies. Banani SF, Rice AM, Peeples WB, Lin Y, Jain S, Parker R, Rosen MK. Cell. 2016 Jul 28;166(3):651-663. doi: 10.1016/j.cell.2016.06.010. Epub 2016 Jun 30. 10.1016/j.cell.2016.06.010 PubMed 27374333