pICSL4723_ Rac5
(Plasmid
#126885)
-
PurposeGenome editing of the wheat homolog of a susceptibility gene of O. sativa. Encodes wheat optimized Cas9 module, nptII resistance gene, and specific sgRNA modules on the binary plasmid pICSL4723.
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 126885 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepICSL4723
-
Vector typeCRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameWheat_live_Cas9
-
gRNA/shRNA sequenceTCGGTTCATCAAGTGCGTGA, GGGGAAGGTGTTGGATGTGT, GGTGACGCACTTTATGAACC, ACGTACGGTGGGGAAGGTGT
-
SpeciesSynthetic
-
Insert Size (bp)8726
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Unknown (unknown if destroyed)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Encodes gene specific sgRNAs driven by the wheat U6 promoter; encodes the plant selectable marker nptII driven by the rice Act1 promoter.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pICSL4723_ Rac5 was a gift from Sophien Kamoun (Addgene plasmid # 126885 ; http://n2t.net/addgene:126885 ; RRID:Addgene_126885)