pCfB8792
(Plasmid
#126910)
-
PurposeTemplate for PCR amplification of ADE2 gRNA biobrick for targeting Saccharomyces cerevisiae ADE2 gene
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 126910 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepUC19
-
Vector typeSynthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameADE2 gRNA
-
gRNA/shRNA sequenceAATTGTAGAGACTATCCACA
-
SpeciesS. cerevisiae (budding yeast)
Cloning Information
- Cloning method Unknown
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCfB8792 was a gift from Irina Borodina (Addgene plasmid # 126910 ; http://n2t.net/addgene:126910 ; RRID:Addgene_126910) -
For your References section:
A teaching protocol demonstrating the use of EasyClone and CRISPR/Cas9 for metabolic engineering of Saccharomyces cerevisiae and Yarrowia lipolytica. Milne N, Tramontin LRR, Borodina I. FEMS Yeast Res. 2019 Sep 26. pii: foz062. doi: 10.1093/femsyr/foz062. 10.1093/femsyr/foz062 PubMed 31556952