-
PurposeExpression of SomArchon under CaMKII promoter
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 126942 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepAAV-CaMKII
- Backbone size w/o insert (bp) 4813
- Total vector size (bp) 6634
-
Vector typeMammalian Expression, AAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameSomArchon
-
SpeciesSynthetic
-
Insert Size (bp)1821
- Promoter CaMKII
-
Tag
/ Fusion Protein
- GFP
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer cgggcaggcgagtggccc
- 3′ sequencing primer CATAGCGTAAAAGGAGCAACA (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAAV-CaMKII-SomArchon was a gift from Edward Boyden (Addgene plasmid # 126942 ; http://n2t.net/addgene:126942 ; RRID:Addgene_126942)