Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

PB-Neo-TetO-Cdk12_Nterm_FlagHa
(Plasmid #127179)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 127179 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    PBNeo-TetO-Dest
  • Backbone manufacturer
    Albert Cheng (Jackson Labs)
  • Backbone size w/o insert (bp) 10369
  • Total vector size (bp) 13274
  • Modifications to backbone
    None
  • Vector type
    Mammalian Expression ; Piggybac Transposase Vector

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    N-terminally Flag- HA- Epitope Tagged Mouse Cyclin Dependent Kinase 12
  • Alt name
    Cdk12
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    4533
  • GenBank ID
    NM_001109626.1
  • Entrez Gene
    Cdk12 (a.k.a. 1810022J16Rik, Crk7, Crkrs, D11Ertd752e, Pksc)
  • Promoter TetO Promoter
  • Tag / Fusion Protein
    • Flag- HA- Tandem Epitopes (N terminal on insert)

Cloning Information

  • Cloning method Gateway Cloning
  • 5′ sequencing primer atccacgctgttttgacctc
  • 3′ sequencing primer agaccgaggagagggttagg
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    PB-Neo-TetO-Cdk12_Nterm_FlagHa was a gift from Phil Sharp (Addgene plasmid # 127179 ; http://n2t.net/addgene:127179 ; RRID:Addgene_127179)
  • For your References section:

    CDK12 regulates DNA repair genes by suppressing intronic polyadenylation. Dubbury SJ, Boutz PL, Sharp PA. Nature. 2018 Dec;564(7734):141-145. doi: 10.1038/s41586-018-0758-y. Epub 2018 Nov 28. 10.1038/s41586-018-0758-y PubMed 30487607