PB-FLuc+GFPd2
(Plasmid
#127190)
-
PurposePiggybac transposon plasmid for expression of CMV promoter firefly luciferase (FLuc) and SV40 destabilized green fluorescent protein (GFPd2)
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 127190 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonePB-CAG-GAPd2
- Backbone size w/o insert (bp) 6466
- Total vector size (bp) 8174
-
Modifications to backboneInsertion of CMV-FLuc-bGH - SV40_prom to replace original CAG promoter of PB-GFPd2. Yields expression of firefly luciferase and destabilized GFPd2 driven by separate promoters.
-
Vector typeMammalian Expression, Luciferase
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameFirefly luciferase
-
Alt nameFLuc
-
Insert Size (bp)1689
-
GenBank IDAAA89082
- Promoter CMV
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site SpeI (not destroyed)
- 3′ cloning site XmaI (not destroyed)
- 5′ sequencing primer cgcaaatgggcggtaggcgtg
- 3′ sequencing primer CTGGTCGAGCTGGACGGCGACG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
PB-FLuc+GFPd2 was a gift from Jordan Green (Addgene plasmid # 127190 ; http://n2t.net/addgene:127190 ; RRID:Addgene_127190)