Skip to main content

PTG
(Plasmid #127198)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 127198 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pBR322
  • Backbone size (bp) 2300
  • Vector type
    Mammalian Expression ; Empty sgRNA plasmid
  • Promoter U6

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ sequencing primer CAGGGTTATTGTCTCATGAGCGGA
  • 3′ sequencing primer CCTGTGTGAAATTGTTATCCGCT
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    PTG was a gift from Jordan Green (Addgene plasmid # 127198 ; http://n2t.net/addgene:127198 ; RRID:Addgene_127198)
  • For your References section:

    Poly(Beta-Amino Ester) Nanoparticles Enable Nonviral Delivery of CRISPR-Cas9 Plasmids for Gene Knockout and Gene Deletion. Rui Y, Varanasi M, Mendes S, Yamagata HM, Wilson DR, Green JJ. Mol Ther Nucleic Acids. 2020 Apr 21;20:661-672. doi: 10.1016/j.omtn.2020.04.005. 10.1016/j.omtn.2020.04.005 PubMed 32380416