PTG
(Plasmid
#127198)
-
Purpose(Empty Backbone) Single template U6 promoter minimal size plasmid
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 127198 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepBR322
- Backbone size (bp) 2300
-
Vector typeMammalian Expression ; Empty sgRNA plasmid
- Promoter U6
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Cloning Information
- Cloning method Restriction Enzyme
- 5′ sequencing primer CAGGGTTATTGTCTCATGAGCGGA
- 3′ sequencing primer CCTGTGTGAAATTGTTATCCGCT
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
PTG was a gift from Jordan Green (Addgene plasmid # 127198 ; http://n2t.net/addgene:127198 ; RRID:Addgene_127198) -
For your References section:
Poly(Beta-Amino Ester) Nanoparticles Enable Nonviral Delivery of CRISPR-Cas9 Plasmids for Gene Knockout and Gene Deletion. Rui Y, Varanasi M, Mendes S, Yamagata HM, Wilson DR, Green JJ. Mol Ther Nucleic Acids. 2020 Apr 21;20:661-672. doi: 10.1016/j.omtn.2020.04.005. 10.1016/j.omtn.2020.04.005 PubMed 32380416