Skip to main content
Holiday Schedule: Addgene will be closed November 24th & 25th for the Thanksgiving Holiday. Order processing and shipping may be delayed during this week. For questions about estimated ship dates, please feel free to track your order status or contact [email protected].
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #127244)


Item Catalog # Description Quantity Price (USD)
Plasmid 127244 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone size w/o insert (bp) 5076
  • Total vector size (bp) 6945
  • Vector type
    Mammalian Expression, AAV

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
  • Growth Strain(s)
    NEB Stable
  • Growth instructions
    Use Rec A- competent cells such as Stbl3 cells from Invitrogen for transformation.
  • Copy number
    High Copy


  • Gene/Insert name
  • Insert Size (bp)
  • Promoter CamKIIa
  • Tags / Fusion Proteins
    • EYFP (C terminal on insert)
    • SpyTag (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer cgggggatccgccaccATG
  • 3′ sequencing primer atatcgaattcttattacttgtacagctcgtccatgcc
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAAV-CaMKIIa-ChRger1-TS-EYFP was a gift from Viviana Gradinaru (Addgene plasmid # 127244 ; ; RRID:Addgene_127244)
  • For your References section:

    Machine learning-guided channelrhodopsin engineering enables minimally invasive optogenetics. Bedbrook CN, Yang KK, Robinson JE, Mackey ED, Gradinaru V, Arnold FH. Nat Methods. 2019 Oct 14. pii: 10.1038/s41592-019-0583-8. doi: 10.1038/s41592-019-0583-8. 10.1038/s41592-019-0583-8 PubMed 31611694