Dom neg CstF64
(Plasmid
#127250)
-
PurposeExpresses the Dominant Negative CstF64 in mammalian cells; DN blocks polyadenylation
-
Depositing Lab
-
Depositing OrganizationUniversity of Pittsburgh (University, School of Medicine, and Cancer Institute)
Located in the United States of America -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 127250 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 127250-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 127250-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepEF1-myc/hisB
-
Backbone manufacturerInvitrogen
- Backbone size w/o insert (bp) 6200
-
Vector typeMammalian Expression ; Other
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameCstF64 delta 282
-
Alt nameCM561
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1700
-
Mutationinsert @SanD1:GTCCAGGCGCCTACCCATACGACGTCCCAGACTACGCTGCTAGT; lacks the last 282 amino acids
-
Entrez GeneCSTF2 (a.k.a. CstF-64)
- Promoter pEF1a
Cloning Information
- Cloning method Unknown
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Removal of the last 282 aa makes a dominant negative. This plasmid was derived from Addgene Plasmid 127251.
DNA (Catalog # 127250-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 127250-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
Dom neg CstF64 was a gift from Christine Milcarek (Addgene plasmid # 127250 ; http://n2t.net/addgene:127250 ; RRID:Addgene_127250) -
For your References section:
Transcription elongation factor ELL2 directs immunoglobulin secretion in plasma cells by stimulating altered RNA processing. Martincic K, Alkan SA, Cheatle A, Borghesi L, Milcarek C. Nat Immunol. 2009 Oct;10(10):1102-9. doi: 10.1038/ni.1786. Epub 2009 Sep 13. 10.1038/ni.1786 PubMed 19749764
