Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

Dom neg CstF64
(Plasmid #127250)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 127250 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pEF1-myc/hisB
  • Backbone manufacturer
    Invitrogen
  • Backbone size w/o insert (bp) 6200
  • Vector type
    Mammalian Expression ; Other
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    CstF64 delta 282
  • Alt name
    CM561
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1700
  • Mutation
    insert @SanD1:GTCCAGGCGCCTACCCATACGACGTCCCAGACTACGCTGCTAGT; lacks the last 282 amino acids
  • Entrez Gene
    CSTF2 (a.k.a. CstF-64)
  • Promoter pEF1a

Cloning Information

  • Cloning method Unknown

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Removal of the last 282 aa makes a dominant negative. This plasmid was derived from Addgene Plasmid 127251.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    Dom neg CstF64 was a gift from Christine Milcarek (Addgene plasmid # 127250 ; http://n2t.net/addgene:127250 ; RRID:Addgene_127250)
  • For your References section:

    Transcription elongation factor ELL2 directs immunoglobulin secretion in plasma cells by stimulating altered RNA processing. Martincic K, Alkan SA, Cheatle A, Borghesi L, Milcarek C. Nat Immunol. 2009 Oct;10(10):1102-9. doi: 10.1038/ni.1786. Epub 2009 Sep 13. 10.1038/ni.1786 PubMed 19749764