Skip to main content

Cdk13_intron3_sg4_pX458
(Plasmid #127339)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 127339 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pX458
  • Backbone manufacturer
    Feng Zhang Lab (Addgene Plasmid #48138)
  • Backbone size w/o insert (bp) 9288
  • Total vector size (bp) 9291
  • Modifications to backbone
    None
  • Vector type
    Mouse Targeting, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    Mouse Cdk13 Intron 3 sgRNA
  • Alt name
    Cdk13
  • gRNA/shRNA sequence
    GTATCTTCCTGCTAAATATC
  • Species
    M. musculus (mouse)
  • Entrez Gene
    Cdk13 (a.k.a. 2310015O17Rik, Cdc2l5)
  • Promoter U6 Promoter

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BbsI (destroyed during cloning)
  • 3′ cloning site BbsI (destroyed during cloning)
  • 5′ sequencing primer LKO.1 5' primer (gactatcatatgcttaccgt)
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please visit https://doi.org/10.1101/824193 for bioRxiv preprint.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    Cdk13_intron3_sg4_pX458 was a gift from Phil Sharp (Addgene plasmid # 127339 ; http://n2t.net/addgene:127339 ; RRID:Addgene_127339)
  • For your References section:

    Oncogenic CDK13 mutations impede nuclear RNA surveillance. Insco ML, Abraham BJ, Dubbury SJ, Kaltheuner IH, Dust S, Wu C, Chen KY, Liu D, Bellaousov S, Cox AM, Martin BJE, Zhang T, Ludwig CG, Fabo T, Modhurima R, Esgdaille DE, Henriques T, Brown KM, Chanock SJ, Geyer M, Adelman K, Sharp PA, Young RA, Boutz PL, Zon LI. Science. 2023 Apr 21;380(6642):eabn7625. doi: 10.1126/science.abn7625. Epub 2023 Apr 21. 10.1126/science.abn7625 PubMed 37079685