Skip to main content
Addgene

pX330-sgR26
(Plasmid #127376)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 127376 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pX330-U6-Chimeric_BB-CBh-hSpCas9
  • Backbone manufacturer
    Feng Zhang laboratory
  • Backbone size w/o insert (bp) 8506
  • Total vector size (bp) 8509
  • Modifications to backbone
    Insertion of gRNA targeting intron 1 of the mouse ROSA26 locus.
  • Vector type
    Mouse Targeting, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    ROSA26
  • gRNA/shRNA sequence
    ACTCCAGTCTTTCTAGAAGA
  • Species
    M. musculus (mouse)
  • Entrez Gene
    Gt(ROSA)26Sor (a.k.a. Gtrgeo26, Gtrosa26, R26, ROSA26, Thumpd3as1)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BbsI (destroyed during cloning)
  • 3′ cloning site BbsI (destroyed during cloning)
  • 5′ sequencing primer not available
  • 3′ sequencing primer tagagccatttgtctgcagaattgg
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    The backbone vector was received from Addgene (Addgene #42230)
  • Article Citing this Plasmid

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pX330-sgR26 was a gift from Lance Miller (Addgene plasmid # 127376 ; http://n2t.net/addgene:127376 ; RRID:Addgene_127376)
  • For your References section:

    Transcriptomic Features of T Cell-Barren Tumors Are Conserved Across Diverse Tumor Types. Routh ED, Pullikuth AK, Jin G, Chifman J, Chou JW, D'Agostino RB Jr, Seino KI, Wada H, Print CG, Zhang W, Lu Y, Miller LD. Front Immunol. 2020 Feb 13;11:57. doi: 10.3389/fimmu.2020.00057. eCollection 2020. 10.3389/fimmu.2020.00057 PubMed 32117236