pX330-sgR26
(Plasmid
#127376)
-
PurposeUsed for contransfection with pR26- and pR26-CMVconst-derived constructs to mediate CRISPR/Cas9 genomic insertion into the murine ROSA26 safe harbor locus.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 127376 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepX330-U6-Chimeric_BB-CBh-hSpCas9
-
Backbone manufacturerFeng Zhang laboratory
- Backbone size w/o insert (bp) 8506
- Total vector size (bp) 8509
-
Modifications to backboneInsertion of gRNA targeting intron 1 of the mouse ROSA26 locus.
-
Vector typeMouse Targeting, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameROSA26
-
gRNA/shRNA sequenceACTCCAGTCTTTCTAGAAGA
-
SpeciesM. musculus (mouse)
-
Entrez GeneGt(ROSA)26Sor (a.k.a. Gtrgeo26, Gtrosa26, R26, ROSA26, Thumpd3as1)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BbsI (destroyed during cloning)
- 3′ cloning site BbsI (destroyed during cloning)
- 5′ sequencing primer not available
- 3′ sequencing primer tagagccatttgtctgcagaattgg (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byThe backbone vector was received from Addgene (Addgene #42230)
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pX330-sgR26 was a gift from Lance Miller (Addgene plasmid # 127376 ; http://n2t.net/addgene:127376 ; RRID:Addgene_127376) -
For your References section:
Transcriptomic Features of T Cell-Barren Tumors Are Conserved Across Diverse Tumor Types. Routh ED, Pullikuth AK, Jin G, Chifman J, Chou JW, D'Agostino RB Jr, Seino KI, Wada H, Print CG, Zhang W, Lu Y, Miller LD. Front Immunol. 2020 Feb 13;11:57. doi: 10.3389/fimmu.2020.00057. eCollection 2020. 10.3389/fimmu.2020.00057 PubMed 32117236