Skip to main content

pTOX5
(Plasmid #127450)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 127450 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pDS132
  • Total vector size (bp) 6640
  • Modifications to backbone
    Extensive - see paper for details
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Chloramphenicol, 25 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Pir1
  • Growth instructions
    NEEDS 2% GLUCOSE
  • Copy number
    Unknown

Gene/Insert 1

  • Gene/Insert name
    mqsR toxin
  • Promoter pRha

Cloning Information for Gene/Insert 1

  • Cloning method Gibson Cloning
  • 5′ sequencing primer tcatctttccctggttgcca
  • 3′ sequencing primer tcaaacatgagaattcgcgga
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    amilCP chromoprotein
  • Mutation
    Codon optimized from protein sequence in FPbase
  • Promoter tac

Cloning Information for Gene/Insert 2

  • Cloning method Gibson Cloning
  • 5′ sequencing primer atgtgtggaaaggcggttca
  • 3′ sequencing primer AGATCCTTGGCGGCAAGAAA
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    Swaine Chen lab
  • Article Citing this Plasmid

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pTOX5 was a gift from Matthew Waldor (Addgene plasmid # 127450 ; http://n2t.net/addgene:127450 ; RRID:Addgene_127450)
  • For your References section:

    A New Suite of Allelic Exchange Vectors for the Scarless Modification of Proteobacterial Genomes. Lazarus JE, Warr AR, Kuehl CJ, Giorgio RT, Davis BM, Waldor MK. Appl Environ Microbiol. 2019 Jun 14. pii: AEM.00990-19. doi: 10.1128/AEM.00990-19. 10.1128/AEM.00990-19 PubMed 31201277
Commonly requested with: