Sox2-t2A-mCherry
(Plasmid
#127538)
-
PurposeExpresses human SOX2 and mCherry via t2A linker.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 127538 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepcDNA3.3-TOPO
-
Backbone manufacturerInvitrogen
- Backbone size w/o insert (bp) 6150
- Total vector size (bp) 7104
-
Modifications to backboneInserted T2a-mCherry at 3' terminal of MCS.
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameSOX2
-
Alt nameANOP3
-
Alt nameMCOPS3
-
SpeciesH. sapiens (human)
-
Insert Size (bp)954
-
GenBank IDNM_003106
-
Entrez GeneSOX2 (a.k.a. ANOP3, MCOPS3)
- Promoter CMV
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
- 3′ sequencing primer TTGGTCACCTTCAGCTTGG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made bySOX2 was subcloned from Harvard Institute of Proteomics (HsCD00079917)
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
Sox2-t2A-mCherry was a gift from Jennifer Mitchell (Addgene plasmid # 127538 ; http://n2t.net/addgene:127538 ; RRID:Addgene_127538) -
For your References section:
KLF4 protein stability regulated by interaction with pluripotency transcription factors overrides transcriptional control. Dhaliwal NK, Abatti LE, Mitchell JA. Genes Dev. 2019 Jun 20. pii: gad.324319.119. doi: 10.1101/gad.324319.119. 10.1101/gad.324319.119 PubMed 31221664