Klf2-t2A-mCherry
(Plasmid
#127539)
-
PurposeExpresses mouse Klf2 and mCherry via t2A linker.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 127539 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepcDNA3.3-TOPO
-
Backbone manufacturerInvitrogen
- Backbone size w/o insert (bp) 5422
- Total vector size (bp) 7212
-
Modifications to backboneInserted T2a-mCherry at 3' terminal of MCS.
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameKlf2
-
Alt nameLklf
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)1790
-
GenBank IDNM_008452
-
Entrez GeneKlf2 (a.k.a. Lklf)
- Promoter CMV
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
- 3′ sequencing primer TTGGTCACCTTCAGCTTGG
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byKlf2 was subcloned from Addgene Plasmid #66655
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
Klf2-t2A-mCherry was a gift from Jennifer Mitchell (Addgene plasmid # 127539 ; http://n2t.net/addgene:127539 ; RRID:Addgene_127539) -
For your References section:
KLF4 protein stability regulated by interaction with pluripotency transcription factors overrides transcriptional control. Dhaliwal NK, Abatti LE, Mitchell JA. Genes Dev. 2019 Jun 20. pii: gad.324319.119. doi: 10.1101/gad.324319.119. 10.1101/gad.324319.119 PubMed 31221664