Skip to main content

CA-Stat3-t2A-mCherry
(Plasmid #127540)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 127540 Standard format: Plasmid sent in bacteria as agar stab 1 $94

Backbone

  • Vector backbone
    pcDNA3.3-TOPO
  • Backbone manufacturer
    Invitrogen
  • Backbone size w/o insert (bp) 6150
  • Total vector size (bp) 8460
  • Modifications to backbone
    Inserted T2a-mCherry at 3' terminal of MCS.
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Stat3
  • Alt name
    Aprf
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    2310
  • Mutation
    A662C and N664C. Residues changed to Cys renders the molecule constitutively active.
  • GenBank ID
    NM_213659
  • Entrez Gene
    Stat3 (a.k.a. 1110034C02Rik, Aprf)
  • Promoter CMV

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
  • 3′ sequencing primer TTGGTCACCTTCAGCTTGG
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Stat3 was subcloned from Addgene plasmid #8722

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

A662C and N664C. Residues changed to Cys renders the molecule constitutively active (Addgene #8722).

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    CA-Stat3-t2A-mCherry was a gift from Jennifer Mitchell (Addgene plasmid # 127540 ; http://n2t.net/addgene:127540 ; RRID:Addgene_127540)
  • For your References section:

    KLF4 protein stability regulated by interaction with pluripotency transcription factors overrides transcriptional control. Dhaliwal NK, Abatti LE, Mitchell JA. Genes Dev. 2019 Jun 20. pii: gad.324319.119. doi: 10.1101/gad.324319.119. 10.1101/gad.324319.119 PubMed 31221664