Skip to main content

MyoUTipGAPi
(Plasmid #127549)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 127549 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pGAPi
  • Backbone manufacturer
    Vidali Lab
  • Backbone size w/o insert (bp) 6647
  • Total vector size (bp) 9575
  • Vector type
    RNAi ; Positive control
  • Selectable markers
    Hygromycin ; 2-Fluoroadenine

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Myosin XIa+b 5'UTR and Adenine Phosphorybosyltransferase transcript segment
  • Alt name
    MyoUTi-APT
  • Alt name
    MyoUTi-APRT
  • Species
    Physcomitrella patens
  • Insert Size (bp)
    829
  • GenBank ID
    HM038541.1 HM038542.1
  • Promoter Ubiquitin

Cloning Information

  • Cloning method Gateway Cloning
  • 5′ sequencing primer CTTTTGTCGATGCTCACCCTG
  • 3′ sequencing primer CCGGCAACAGGATTCAATCTT
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    MyoUTipGAPi was a gift from Luis Vidali (Addgene plasmid # 127549 ; http://n2t.net/addgene:127549 ; RRID:Addgene_127549)
  • For your References section:

    Robust survival-based RNAi of gene families using in tandem silencing of adenine phosphoribosyltransferase. Orr RG, Foley SJ, Sherman CA, Abreu I, Galotto G, Liu B, Gonzalez-Guerrero M, Vidali L. Plant Physiol. 2020 Aug 6. pii: pp.20.00865. doi: 10.1104/pp.20.00865. 10.1104/pp.20.00865 PubMed 32764132
Commonly requested with: