Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pGAPi
(Plasmid #127547)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 127547 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pGAPi
  • Backbone manufacturer
    Vidali Lab
  • Backbone size (bp) 11239
  • Vector type
    RNAi
  • Promoter Ubiquitin
  • Selectable markers
    Hygromycin ; 2-Fluoroadenine

Growth in Bacteria

  • Bacterial Resistance(s)
    Chloramphenicol and Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    ccdB Survival
  • Copy number
    High Copy

Cloning Information

  • Cloning method Gateway Cloning
  • 5′ sequencing primer cttttgtcgatgctcaccctg
  • 3′ sequencing primer ccggcaacaggattcaatctt
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pGAPi was a gift from Luis Vidali (Addgene plasmid # 127547 ; http://n2t.net/addgene:127547 ; RRID:Addgene_127547)
  • For your References section:

    Robust survival-based RNAi of gene families using in tandem silencing of adenine phosphoribosyltransferase. Orr RG, Foley SJ, Sherman CA, Abreu I, Galotto G, Liu B, Gonzalez-Guerrero M, Vidali L. Plant Physiol. 2020 Aug 6. pii: pp.20.00865. doi: 10.1104/pp.20.00865. 10.1104/pp.20.00865 PubMed 32764132