-
PurposeCRISPaint universal donor plasmid for gene exon insertion. Encodes T2A-Gal4-SV40 and 3xP3-RFP visible eye marker.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 127556 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepBluescript, pHD-dsRed, pHD-Gal4-DsRed, and gBlock fragment
-
Backbone manufacturerStratagene, Kate O'Connor-Giles, Justin Bosch, Norbert Perrimon
-
Vector typeInsect Expression, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameGal4
-
Alt nameT2A-Gal4
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer GTAAAACGACGGCCAG
- 3′ sequencing primer GGAAAGTCCTTGGGGTCTTC
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCRISPaint-T2A-Gal4-3xP3-RFP was a gift from Norbert Perrimon (Addgene plasmid # 127556 ; http://n2t.net/addgene:127556 ; RRID:Addgene_127556) -
For your References section:
Gene Knock-Ins in Drosophila Using Homology-Independent Insertion of Universal Donor Plasmids. Bosch JA, Colbeth R, Zirin J, Perrimon N. Genetics. 2019 Nov 4. pii: genetics.119.302819. doi: 10.1534/genetics.119.302819. 10.1534/genetics.119.302819 PubMed 31685521