Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more


(Plasmid #127556)


This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 127556 Standard format: Plasmid sent in bacteria as agar stab 1 $85


  • Vector backbone
    pBluescript, pHD-dsRed, pHD-Gal4-DsRed, and gBlock fragment
  • Backbone manufacturer
    Stratagene, Kate O'Connor-Giles, Justin Bosch, Norbert Perrimon
  • Vector type
    Insect Expression, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
  • Growth Strain(s)
  • Copy number
    High Copy


  • Gene/Insert name
  • Alt name

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer GTAAAACGACGGCCAG
  • 3′ sequencing primer GGAAAGTCCTTGGGGTCTTC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCRISPaint-T2A-Gal4-3xP3-RFP was a gift from Norbert Perrimon (Addgene plasmid # 127556 ; ; RRID:Addgene_127556)
  • For your References section:

    Gene Knock-Ins in Drosophila Using Homology-Independent Insertion of Universal Donor Plasmids. Bosch JA, Colbeth R, Zirin J, Perrimon N. Genetics. 2019 Nov 4. pii: genetics.119.302819. doi: 10.1534/genetics.119.302819. 10.1534/genetics.119.302819 PubMed 31685521