Skip to main content
Addgene

pSLQ-5S-F30-Mango IV
(Plasmid #127584)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 127584 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pSLQ
  • Backbone size w/o insert (bp) 8205
  • Total vector size (bp) 8425
  • Vector type
    Mammalian Expression
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    5S rRNA with F30 folding scaffold and Mango IV tag
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    220
  • Promoter modified U6

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BstXI (not destroyed)
  • 3′ cloning site XhoI (not destroyed)
  • 5′ sequencing primer TTCGGGTTTATTACAGGGACAG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pSLQ-5S-F30-Mango IV was a gift from David Rueda (Addgene plasmid # 127584 ; http://n2t.net/addgene:127584 ; RRID:Addgene_127584)
  • For your References section:

    Fluorogenic RNA Mango aptamers for imaging small non-coding RNAs in mammalian cells. Autour A, C Y Jeng S, D Cawte A, Abdolahzadeh A, Galli A, Panchapakesan SSS, Rueda D, Ryckelynck M, Unrau PJ. Nat Commun. 2018 Feb 13;9(1):656. doi: 10.1038/s41467-018-02993-8. 10.1038/s41467-018-02993-8 [pii] PubMed 29440634