pSLQ-mgU2-47-Mango II
(Plasmid
#127586)
-
PurposeExpresses mgU2-47-Mango II scaRNA from a mU6 promoter
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 127586 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepSLQ
- Backbone size w/o insert (bp) 8205
- Total vector size (bp) 8411
-
Vector typeMammalian Expression
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namemgU2-47 scaRNA with Mango II tag
-
SpeciesH. sapiens (human)
-
Insert Size (bp)206
- Promoter modified U6
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BstXI (not destroyed)
- 3′ cloning site XhoI (not destroyed)
- 5′ sequencing primer TTCGGGTTTATTACAGGGACAG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pSLQ-mgU2-47-Mango II was a gift from David Rueda (Addgene plasmid # 127586 ; http://n2t.net/addgene:127586 ; RRID:Addgene_127586) -
For your References section:
Fluorogenic RNA Mango aptamers for imaging small non-coding RNAs in mammalian cells. Autour A, C Y Jeng S, D Cawte A, Abdolahzadeh A, Galli A, Panchapakesan SSS, Rueda D, Ryckelynck M, Unrau PJ. Nat Commun. 2018 Feb 13;9(1):656. doi: 10.1038/s41467-018-02993-8. 10.1038/s41467-018-02993-8 [pii] PubMed 29440634