pBT2-4xUAS:P2A-mCerulean3
(Plasmid
#127592)
-
Purpose(Empty Backbone) This vector is used for cloning a gene driven by 4xnrUAS, to be co-expressed with mCerulean3 through P2A self-cleaving peptides.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 127592 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepBT2
-
Vector typeZebrafish expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Cloning Information
- Cloning method Restriction Enzyme
- 5′ sequencing primer CGGTGGTGCAGATGAACTTCAG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pBT2-4xUAS:P2A-mCerulean3 was a gift from Longhou Fang (Addgene plasmid # 127592 ; http://n2t.net/addgene:127592 ; RRID:Addgene_127592) -
For your References section:
AIBP-mediated cholesterol efflux instructs hematopoietic stem and progenitor cell fate. Gu Q, Yang X, Lv J, Zhang J, Xia B, Kim JD, Wang R, Xiong F, Meng S, Clements TP, Tandon B, Wagner DS, Diaz MF, Wenzel PL, Miller YI, Traver D, Cooke JP, Li W, Zon LI, Chen K, Bai Y, Fang L. Science. 2019 Mar 8;363(6431):1085-1088. doi: 10.1126/science.aav1749. Epub 2019 Jan 31. 10.1126/science.aav1749 PubMed 30705153