Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pDESTtol2pACrymCherry
(Plasmid #64023)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 64023 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pDestTol2pA2
  • Backbone manufacturer
    Kwan et al., 2007
  • Vector type
    Gateway
  • Selectable markers
    ccdB gene

Growth in Bacteria

  • Bacterial Resistance(s)
    Chloramphenicol and Ampicillin, 25 & 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    ccdB Survival
  • Growth instructions
    to be propagated like other Gateway destination vectors (such as pDESTR4-R3). Invitrogen recommend their "ccdB Survival 2 T1R E. coli strain" plus 100 μg/ml ampicillin and 15–30 μg/ml chloramphenicol.
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    mCherry
  • Species
    D. rerio (zebrafish)
  • Promoter alpha-Acrystallin promoter

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site XhoI (not destroyed)
  • 3′ cloning site SfiI (unknown if destroyed)
  • 5′ sequencing primer M13Forward
  • 3′ sequencing primer AGAGAGCATTATTGTAGGAAATG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pDESTtol2pACrymCherry was a gift from Joachim Berger & Peter Currie (Addgene plasmid # 64023 ; http://n2t.net/addgene:64023 ; RRID:Addgene_64023)
  • For your References section:

    503unc, a small and muscle-specific zebrafish promoter. Berger J, Currie PD. Genesis. 2013 Jun;51(6):443-7. doi: 10.1002/dvg.22385. Epub 2013 Mar 26. 10.1002/dvg.22385 PubMed 23444339