Skip to main content

pLentiCRISPRv2 sgBLM10
(Plasmid #127643)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 127643 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pLentiCRISPRv2
  • Vector type
    Lentiviral
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    IRF3 sgRNA
  • gRNA/shRNA sequence
    GGAACGAACTGCTTCAGCAG
  • Species
    H. sapiens (human)
  • Entrez Gene
    IRF3 (a.k.a. IIAE7)

Cloning Information

  • Cloning method Unknown

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLentiCRISPRv2 sgBLM10 was a gift from Nicolas Manel (Addgene plasmid # 127643 ; http://n2t.net/addgene:127643 ; RRID:Addgene_127643)
  • For your References section:

    Bloom syndrome protein restrains innate immune sensing of micronuclei by cGAS. Gratia M, Rodero MP, Conrad C, Bou Samra E, Maurin M, Rice GI, Duffy D, Revy P, Petit F, Dale RC, Crow YJ, Amor-Gueret M, Manel N. J Exp Med. 2019 May 6;216(5):1199-1213. doi: 10.1084/jem.20181329. Epub 2019 Apr 1. 10.1084/jem.20181329 PubMed 30936263