Skip to main content

"AND-gate" receiver plasmid
(Plasmid #127676)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 127676 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pSB1A3
  • Backbone size w/o insert (bp) 2100
  • Total vector size (bp) 3964
  • Vector type
    Bacterial Expression, Synthetic Biology

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    LuxR, GFP
  • Species
    Synthetic; Aliivibrio fischeri
  • Insert Size (bp)
    1900
  • Promoter pLlacO-1 for LuxR, pLux for GFP

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (not destroyed)
  • 3′ cloning site SpeI (not destroyed)
  • 5′ sequencing primer TGCCACCTGACGTCTAAGAA
  • 3′ sequencing primer ATTACCGCCTTTGAGTGAGC
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    The plasmids were first used in the publication of Weitz et al. J. Am. Chem. Soc., 2014, 136, 72–75.

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

The insert was cloned by A. Mückl.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    "AND-gate" receiver plasmid was a gift from Friedrich Simmel (Addgene plasmid # 127676 ; http://n2t.net/addgene:127676 ; RRID:Addgene_127676)
  • For your References section:

    Chemical communication between bacteria and cell-free gene expression systems within linear chains of emulsion droplets. Schwarz-Schilling M, Aufinger L, Muckl A, Simmel FC. Integr Biol (Camb). 2016 Apr 18;8(4):564-70. doi: 10.1039/c5ib00301f. Epub 2016 Jan 18. 10.1039/c5ib00301f PubMed 26778746