pSH69
(Plasmid
#127702)
-
PurposePrab-3::ssGFP1-10
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 127702 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backboneprab-3
- Backbone size w/o insert (bp) 4300
- Total vector size (bp) 4914
-
Vector typeWorm Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namessGFP-1/10
-
SpeciesSynthetic
-
Insert Size (bp)642
- Promoter rab-3
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer aaaaaagcaggcttaatgttctccgagttacgaatacttcg
- 3′ sequencing primer CAAGaaagctgggtaTTTTTCATTTGGATCTTTGCTCAGGACTGT
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pSH69 was a gift from David M. Miller (Addgene plasmid # 127702 ; http://n2t.net/addgene:127702 ; RRID:Addgene_127702) -
For your References section:
NATF (Native And Tissue-Specific Fluorescence): A Strategy for Bright, Tissue-Specific GFP Labeling of Native Proteins in Caenorhabditis elegans. He S, Cuentas-Condori A, Miller DM. Genetics. 2019 Apr 5. pii: genetics.119.302063. doi: 10.1534/genetics.119.302063. 10.1534/genetics.119.302063 PubMed 30952669