pAAV-hSyn-3xFLAG-WPRE
(Plasmid
#127862)
-
PurposepAAV plasmid expressing 3xFLAG under the hSyn promoter
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 127862 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepAAV
- Backbone size w/o insert (bp) 4578
- Total vector size (bp) 4644
-
Vector typeAAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert name3xFLAG
-
SpeciesSynthetic
-
Insert Size (bp)66
- Promoter hSyn
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (not destroyed)
- 3′ cloning site NheI (not destroyed)
- 5′ sequencing primer cactgccagcttcagcac
- 3′ sequencing primer CATAGCGTAAAAGGAGCAACA (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byThe backbone was obtained from pAAV-hSyn-hChR2(H134R)-mCherry, a gift from Karl Deisseroth (Addgene plasmid # 26976).
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAAV-hSyn-3xFLAG-WPRE was a gift from Florian Freudenberg (Addgene plasmid # 127862 ; http://n2t.net/addgene:127862 ; RRID:Addgene_127862) -
For your References section:
Interaction of NOS1AP with the NOS-I PDZ domain: Implications for schizophrenia-related alterations in dendritic morphology. Candemir E, Kollert L, Weissflog L, Geis M, Muller A, Post AM, O'Leary A, Harro J, Reif A, Freudenberg F. Eur Neuropsychopharmacol. 2016 Apr;26(4):741-55. doi: 10.1016/j.euroneuro.2016.01.008. Epub 2016 Jan 28. 10.1016/j.euroneuro.2016.01.008 PubMed 26861996