Mouse 3' Ubf AID GFP PuroR
(Plasmid
#127901)
-
PurposeHDR (donor) Plasmid for Inserting AID-GFP-2A-Puro into the 3' end of the Mouse Ubf Gene
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 127901 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepBSK
-
Vector typeDonor plasmid
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameUbf
-
Alt nameupstream binding transcription factor
-
Alt nameUbtf
-
SpeciesM. musculus (mouse), A. thaliana (mustard weed)
-
Insert Size (bp)2097
-
MutationInserting GFP AID 2A Puro into mouse 3' Ubf
-
GenBank IDNC_000077.6
-
Entrez GeneUbtf (a.k.a. A930005G04Rik, NOR-90, Tcfubf, UBF, UBF-1, UBF1)
-
Tag
/ Fusion Protein
- GFP, AID, PuroR
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer tgctgcaaggcgattaagttgg
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
Mouse 3' Ubf AID GFP PuroR was a gift from Mark Groudine (Addgene plasmid # 127901 ; http://n2t.net/addgene:127901 ; RRID:Addgene_127901)