Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pX330 Mouse 3' Ubf gRNA
(Plasmid #127902)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 127902 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pX330-U6-Chimeric_BB-CBh-hSpCas9
  • Modifications to backbone
    gRNA to Ubf
  • Vector type
    CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    gRNA for Mouse 3' Ubf
  • gRNA/shRNA sequence
    tcggattctgactccaactg

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BbsI (destroyed during cloning)
  • 3′ cloning site BbsI (destroyed during cloning)
  • 5′ sequencing primer cacctctgacttgagcgtcg
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    https://www.addgene.org/42230/

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pX330 Mouse 3' Ubf gRNA was a gift from Mark Groudine (Addgene plasmid # 127902 ; http://n2t.net/addgene:127902 ; RRID:Addgene_127902)